Universal Adapter PCR Primers Multiplex Oligos 2 For Illumina K002-B

Universal Adapter PCR Primers Multiplex Oligos 2 For Illumina K002-B

Product Details:

Place of Origin: China
Brand Name: GDSBio
Certification: ISO9001, ISO13485
Model Number: K002-B

Payment & Shipping Terms:

Minimum Order Quantity: 1 Kit
Price: /
Packaging Details: small package or bulk distribute or OEM
Delivery Time: 8 work days
Payment Terms: L/C, D/A, D/P, T/T, Western Union, MoneyGram
Supply Ability: 1000 Kits per Day
Get Best Price Contact Now

Detail Information

Catalog No: V9001 Size: 48 Tests/kit, 96 Tests/kit
Sample Type: DNA Platform: Illumina
Storage Condition: -20°C Shelf Life: 12 Months
High Light:

Universal Adapter PCR Primers

,

Multiplex Oligos 2 Adapter PCR Primers

Product Description

Multiplex Oligos 2 for Illumina

【Product Name】

Multiplex Oligos 2 for Illumina

【Cat. No./Spec.】

K002-B/192 rxns

【Product Description】

#K002-B Multiplex Oligos 1 for Illumina includes the universal adapter as well as 8 i5 PCR Primers and 12 i7 PCR Primers, each containing 8 nt index, allowing the construction of 96 different combinations of unique dual index libraries. When used with #K002-A Multiplex Oligos 2 for Illumina, 384 different combinations of dual index libraries can be constructed.

【Storage Condition & Shelf Life】

All reagents should be stored at -20°C. The product is valid for 12 months.

Do not premix Adapter, Ligation Buffer and DNA Ligase before use to avoid formation of excessive Adapter dimer.

【Scope of application】

This product is a special adapter primer kit for # K001 Fast DNA Library Prep Kit, which is applicable for Illumina platform.

【Components】

Component

Specification

(192rxns)

Adapter 960μl

 

i5 PCR Primer Specification
KP509 90μl
KP510 90μl
KP511 90μl
KP512 90μl
KP513 90μl
KP514 90μl
KP515 90μl
KP516 90μl

 

i7 PCR Primer Specification
KP713 60μl
KP714 60μl
KP715 60μl
KP716 60μl
KP717 60μl
KP718 60μl
KP719 60μl
KP720 60μl
KP721 60μl
KP722 60μl
KP723 60μl
KP724 60μl

 

Sequence Information

Adapter:

5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’

5’-GATCGGAAGAGCACACGTCTGAACTCCAGTC-3’

i5 PCR Primer:

5’-AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCT

C-3’

i7 PCR Primer:

5’-CAAGCAGAAGACGGCATACGAGAT[i7]GTGACTGGAGTTCAGACGTGTGCTCT-3’

Universal Adapter PCR Primers Multiplex Oligos 2 For Illumina K002-B 0Universal Adapter PCR Primers Multiplex Oligos 2 For Illumina K002-B 1

GDSBio is a high-tech company focused on the development, production and marketing of quality life science products. The company has a complete product line, with PCR technology as the core, focusing on ordinary PCR, fluorescent quantitative PCR, NGS library construction, nucleic acid electrophoresis and other molecular biology technologies, and has developed molecular scientific research reagents, molecular in vitro diagnostic raw materials, nucleic acid extraction and detection reagents and other products.

Universal Adapter PCR Primers Multiplex Oligos 2 For Illumina K002-B 2

Want to Know more details about this product
I am interested in Universal Adapter PCR Primers Multiplex Oligos 2 For Illumina K002-B could you send me more details such as type, size, quantity, material, etc.
Thanks!
Waiting for your reply.