Universal Adapter PCR Primers Multiplex Oligos 1 For Illumina K002-A
Product Details:
Place of Origin: | China |
Brand Name: | GDSBio |
Certification: | ISO9001, ISO13485 |
Model Number: | K002-A |
Payment & Shipping Terms:
Minimum Order Quantity: | 1 Box |
---|---|
Packaging Details: | small package or bulk distribute or OEM |
Delivery Time: | 8 work days |
Payment Terms: | L/C, D/A, D/P, T/T, Western Union, MoneyGram |
Supply Ability: | 10000 Box per Day |
Detail Information |
|||
Cat. No.: | K002-A | Specification: | 192 Rxns |
---|---|---|---|
Appearance: | Complete, No Damage | Stock: | Yes |
Logo Printing: | With Logo Printing | Transport Package: | Packing |
Shelf Life: | 12 Months | Storage Conditions: | Stored At -20°C |
High Light: | PCR Primers Multiplex Oligos 1,Universal Adapter Multiplex Oligos 1 |
Product Description
Multiplex Oligos 1 for Illumina
【Product Name】
Multiplex Oligos 1 for Illumina
【Cat. No./Spec.】
K002-A/192 rxns
【Product Description】
#K002-A Multiplex Oligos 1 for Illumina includes the universal adapter as well as 8 i5 PCR Primers and 12 i7 PCR Primers, each containing 8 nt index, allowing the construction of 96 different combinations of unique dual index libraries. When used with #K002-B Multiplex Oligos 2 for Illumina, 384 different combinations of dual index libraries can be constructed.
【Storage Condition & Shelf Life】
All reagents should be stored at -20°C. The product is valid for 12 months.
Do not premix Adapter, Ligation Buffer and DNA Ligase before use to avoid formation of excessive Adapter dimer.
【Scope of application】
This product is a special adapter primer kit for # K001 Fast DNA Library Prep Kit, which is applicable for Illumina platform.
Sequence Information
Adapter:
5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’
5’-GATCGGAAGAGCACACGTCTGAACTCCAGTC-3’
i5 PCR Primer:
5’-AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCT
C-3’
i7 PCR Primer:
5’-CAAGCAGAAGACGGCATACGAGAT[i7]GTGACTGGAGTTCAGACGTGTGCTCT-3’