Universal Adapter PCR Primers Multiplex Oligos 1 For Illumina K002-A

Universal Adapter PCR Primers Multiplex Oligos 1 For Illumina K002-A

Product Details:

Place of Origin: China
Brand Name: GDSBio
Certification: ISO9001, ISO13485
Model Number: K002-A

Payment & Shipping Terms:

Minimum Order Quantity: 1 Box
Packaging Details: small package or bulk distribute or OEM
Delivery Time: 8 work days
Payment Terms: L/C, D/A, D/P, T/T, Western Union, MoneyGram
Supply Ability: 10000 Box per Day
Get Best Price Contact Now

Detail Information

Stock: Yes Cat. No.: K002-A
Specification: 192 Rxns Appearance: Complete, No Damage
Logo Printing: With Logo Printing Transport Package: Packing
Shelf Life: 12 Months Storage Conditions: Stored At -20°C
High Light:

PCR Primers Multiplex Oligos 1

,

Universal Adapter Multiplex Oligos 1

Product Description

Multiplex Oligos 1 for Illumina

【Product Name】

Multiplex Oligos 1 for Illumina

【Cat. No./Spec.】

K002-A/192 rxns

【Product Description】

#K002-A Multiplex Oligos 1 for Illumina includes the universal adapter as well as 8 i5 PCR Primers and 12 i7 PCR Primers, each containing 8 nt index, allowing the construction of 96 different combinations of unique dual index libraries. When used with #K002-B Multiplex Oligos 2 for Illumina, 384 different combinations of dual index libraries can be constructed.

【Storage Condition & Shelf Life】

All reagents should be stored at -20°C. The product is valid for 12 months.

Do not premix Adapter, Ligation Buffer and DNA Ligase before use to avoid formation of excessive Adapter dimer.

【Scope of application】

This product is a special adapter primer kit for # K001 Fast DNA Library Prep Kit, which is applicable for Illumina platform.

Sequence Information

Adapter:

5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’

5’-GATCGGAAGAGCACACGTCTGAACTCCAGTC-3’

 

i5 PCR Primer:

5’-AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCT

C-3’

i7 PCR Primer:

5’-CAAGCAGAAGACGGCATACGAGAT[i7]GTGACTGGAGTTCAGACGTGTGCTCT-3’

Universal Adapter PCR Primers Multiplex Oligos 1 For Illumina K002-A 0

 

Want to Know more details about this product
I am interested in Universal Adapter PCR Primers Multiplex Oligos 1 For Illumina K002-A could you send me more details such as type, size, quantity, material, etc.
Thanks!
Waiting for your reply.